The “natural law of free evolution” – a mechanical basis of the ecological structure
In the ecosystem of planet Earth, it is impossible for one species to sustainably determine any characteristics of the subsequent generations of another species for its own benefit. Even among viruses and microbes, there are many theoretical possibilities for the development of such strategies. However, as these cannot function sustainably, they have not become established in any empirically described case. The reason for this is that life forms only remain stable across generations if their characteristics are primarily aligned to their own advantage in natural selection. If this is prevented, genetic degeneration and increasing instability occur. Both the manipulated organism and a manipulator specialised in it inevitably move into an evolutionary dead end.
The civilisational agricultural method of artificial selective breeding for the primary benefit of humans was thus such a dead end from the outset. The fact that it appeared to work for several millennia was due to the fact that very large quantities of original genetic resources from numerous plants and animals were virtually burned up, which took some time due to the volume involved. This ‘combustion’ led to a short-term sharp increase in the amount of food available and, as a causal consequence, to a population explosion. Now, however, eight billion people exist on an unstable foundation of genetically highly degenerated and unviable organisms. If certain statements made by the 19th-century naturalist Charles Darwin had been given due consideration, the last, particularly fatal phase of development could at least have been slowed down considerably.
Preliminary remarks: According to the criteria of true reason, the issues discussed here would have to be treated as a top priority in the natural sciences as a whole. The fact that the methodology of artificial selective breeding and, consequently, the basis of existence for eight billion people runs counter to fundamental ecological orders has far-reaching and fatal consequences for both humans themselves and the Earth’s ecosystem. Agriculture and its increasing intensification were the cause of the population explosion and today’s overpopulation. Its ecological impact is considered the main cause of an ongoing sixth mass extinction in the history of life on Earth. In fact, however, critical reflections on agricultural methodology and its fundamental unnaturalness are rejected in sciences. As a result, there is also a failure to understand that any such targeted intervention in evolution is leading towards a dead end, regardless of whether it is achieved through conventional selective breeding or newer agricultural genetic engineering techniques. Currently, a considerable portion of the academic life sciences are focusing on supposed solutions in the form of ‘modern’ genetic engineering techniques and are promoting these publicly. Ironically, it is precisely this branch of science, whose historical failures have already had serious consequences and which would be mainly responsible for a long-overdue revelation of the deeper background, that is now leading humanity into a fatal illusion, similar to a lost hiking guide who leads his proteges in the desert towards a mirage.
What is referred to here as the ‘natural law of free evolution’ is not a discovery made by the authors of this article. Rather, the ecological orders in question were described much earlier. The researcher Charles Darwin placed them at the centre of his theory as a key insight. He wrote several times that his ‘theory would be destroyed’ if even a single example were discovered anywhere in nature in which any characteristic of any species had arisen for the exclusive benefit of another species. The following is a translation of a relevant passage from his magnum opus ‘On the Origin of Species’ from 1859:
„Natural selection cannot possibly produce any modification in any species which is of exclusive advantage to another species, although throughout nature one species constantly derives benefit and advantage from the organisation of another. (…) If it could be proved that any part of the organisation of one species had been formed for the exclusive benefit of another species, my theory would be destroyed, because such a formation cannot be brought about by natural selection. Although many assertions of this kind have been made in natural history writings, I cannot find a single one of them that carries any weight.„
[1] Charles Darwin, 1859. (The original passage is linked to Darwin Online in the references.)
Darwin was so certain of this that he even made his entire theory inextricably linked to this one point. If anyone had ever proven that a species in nature had developed a characteristic that only benefited another species, then practically the entire work of the famous naturalist would have collapsed.
But in fact, he has been proven right to this day. Although there are occasional claims of alleged counterevidence, these always dissolve as soon as they are examined more closely. Sometimes such misrepresentations even come from academic life scientists, which is usually due to the severe underdevelopment of the field with regard to the larger ecological context. Examples of this can be found in ZEIS Magazine.
Also in his magnum opus, Darwin stated with great clarity that artificial selection by humans, i.e. the core of agricultural methodology, runs diametrically counter to the regularity described in the first quotation, because it produces characteristics in other living beings that are only useful to humans. Here is a second quote, also translated from his magnum opus (the original passage is linked to Darwin Online in the references):
‘One of the most remarkable peculiarities we perceive in our domesticated breeds is their adaptation not for the benefit of the plant or animal itself, but for the benefit and amusement of humans.’ [2]
The significance of the two quotations shown is enormous. On the one hand, there is the law of nature of free evolution mentioned at the beginning as a central ecological regularity. On the other hand, humans have practically oriented their entire existence in the opposite direction. Since the method of artificial selection resulted in a very sharp increase in the amount of food generated from it in the short term, it ultimately multiplied explosively. But now there are eight billion people living on a food supply that runs counter to basic ecological principles. Since, as we know, the laws of nature cannot be broken, this has undoubtedly created an extremely dire situation.
The absence of intergenerational manipulation throughout nature can only be because it does not work sustainably
The mechanical background of the natural law of free evolution will now be examined. It can be stated in advance that, despite millions of empirical descriptions of often extremely complex symbiotic, parasitic and other relationships between viruses, microorganisms, fungi, plants and animals, not a single example of even the smallest characteristic in any species has been proven to have developed for the exclusive benefit of another species. When considering this, the multi-stage history of the development of the respective characteristics must always be taken into account. For example, if an insect benefits from the flower of a plant because it provides nectar and is also conspicuous in colour, then the development of these characteristics was always based on the primary benefit to the plant, because the insect promoted its fertilisation and reproduction.
Why it is impossible in a sustainable sense for characteristics to arise for the exclusive benefit of another species becomes apparent when considering the structures of genomes and the processes of the further development of living beings in the context of evolution. One thing can be assumed with certainty: if the manipulative intervention of one species in the evolution of other life forms could function sustainably, i.e. if it were a potential model for success, then diverse strategies aimed precisely at this would have had to have developed in the realms of single-celled organisms and viruses over billions of years. There would therefore have to be breeding strategies. For example, horizontal gene transfer between microorganisms is virtually an everyday occurrence in nature. And many viruses even specialise in penetrating the genome of their (individual) hosts and carrying out targeted and precise manipulations from there. This targeting and precision often occur in much higher dimensions of complexity than our relatively primitive artificial breeding selection or genetic engineering. Nevertheless, there is not a single proven case of such manipulations that specifically extend to the characteristics and properties of subsequent generations of the host and thus, in effect, the ‘victim’. Why not?
A vivid example that helps us understand that the absence of ‘breeding’ in nature has nothing to do with a lack of theoretical possibility, complexity or specificity is the reproductive strategy of viruses from the Baculoviridae family, which has existed for around 300 million years: They manipulate caterpillars in an extremely precise manner so that they first crawl up to the highest tops of trees, contrary to their healthy behaviour. Once there, the virus switches off the caterpillars‘ feeding instinct. As a result, they continue to swell with virus-saturated body fluid. Eventually, they burst. The dripping droplets contaminate the leaves in the lower regions of the plant and thus the food of the caterpillars that are still healthy there. Before they burst, the infected caterpillars attach themselves to the treetops with a silk thread to ensure that they do not fall down before the droplets fall. This multi-stage parasitic strategy, which has evolved over millions of years of evolutionary selection, is precisely encoded in the genetic material of the viruses and includes, among other things, targeted interventions in the nervous system, metabolism and hormone balance of the caterpillars. The overall complexity and precision far exceed those of artificial selective breeding and genetic engineering practised by humans in agriculture. If targeted ‘breeding’ in the sense of influencing evolution between different forms of life to achieve sustainable advantages for the manipulator were to work, then a wide variety of such strategies would have had to have developed at the level of viruses and microorganisms during the billions of years of evolutionary selection. But not a single example, however minor, has ever been found. All parasites only ever manipulate the current generations of their hosts [4].
The complete absence of any cross-generational manipulation between different species throughout the entire ecosystem (apart from human influences) allows only one logical conclusion: that it cannot function sustainably. And reflection on evolutionary mechanisms reveals the decisive reason: the manipulator would always weaken the manipulated side if it were not primarily selected for its own benefit by all surrounding influences. Only by being selected – or, one might say, “tested” – by all the many different natural influences, without external manipulation, can the variations of a life form that are always present due to mutations retain their sustainable stability in the constantly changing structure of environmental influences. This means that, in order for the species to remain stable as a reproductive community, it is always the siblings that are best able to withstand the sum of environmental pressures that are most likely to reproduce.
External intervention in the evolution of a life form invariably leads to its weakening.
A manipulator could generate its own, perhaps even very large, benefit over several generations of the manipulated life form, for example by increasing the amount of food. The possible number of these consequences is variable. However, the manipulated side would certainly ‘slip through their fingers’ from the very first of these generations, because the elimination of natural selection would weaken it in some way in relation to the countless interacting and therefore uncontrollably complex influences of nature. As this process progresses, the manipulator’s advantages will inevitably turn into disadvantages for its own stable continuity. Since the manipulator had to specialise, it has become dependent on increasingly weakened life forms and has thus approached the end of an evolutionary dead end from the outset – where its own lineage must virtually burn out, like a short shooting star.
It is not unlikely that such ‘shooting stars’ could be found if it were possible to observe the history of life on Earth in retrospect with the utmost precision. These would be, for example, types of viruses in which random mutations have given rise to characteristics that influence the evolution of their hosts, such as a species of bacteria, in small ways, in order to make their offspring more compliant by weakening their immune system, for example. However, because these new generations of bacteria automatically became weaker (relative to natural selection) as a result of the manipulation, in terms of their resilience in the overall structure of environmental influences, a corresponding viral strategy could never really develop [4].
The externally uncontrollable complexity of every genome
The deeper mechanical basis of the natural law of free evolution is easy to name and can also be proven mathematically. It consists in the fact that the storage capacities of the genetic material of every life form, down to the relatively ‘simplest’ microorganisms and even viruses, is very high, tending towards infinity, and that over a process of evolution lasting hundreds of millions or even several billion years, they have filled themselves with information in order to form an organisation that is capable of surviving as sustainably as possible in a practically infinitely complex and constantly changing environmental pressure. Due to this uncontrollably high complexity, it is completely impossible in a sustainable sense for a manipulator to steer the evolution of another for their own – sustainable – benefit.
To begin to understand these incomprehensibly extreme complexities, it is best to first look at the mechanical basics of the genetic memory of all living beings. At first glance, these function in a surprisingly simple way. In all forms of life, this occurs in a sequence of identical molecules of the four nucleotide bases adenine, thymine, guanine and cytosine, abbreviated as A, T, G and C (note: RNA viruses are excluded for simplicity). The molecules are held in pairs (‘base pairs’) by various auxiliary substances and are arranged in long strands. The entire mixture of nucleotides and auxiliary substances is called ‘deoxyribonucleic acid’, abbreviated to “DNA” or, more commonly today, ‘DNA’. Every single living cell contains such long ‘strings of letters’. And in multicellular organisms, they are exactly the same in every single cell of the body.
As for the information they contain, it can be thought of simply as codes within the variable sequences of A, T, G and C. These codes are specifically ‘read’ by other cell organs as needed and then translated into various functions. The best known of these is the formation of variable proteins, i.e. protein building blocks. The physical substance of a living being consists of many different such proteins. In addition, the entire blueprint is also encoded in the genetic material. The complete code of a genome could therefore begin as follows and then continue with many more of the same four ‘letters’ in varying combinations:
AGGATCCTACGTAGTGACCGTTGTCTAAGTCGACTTGATGTTGTCTAA (…)
This variable sequence of four identical ‘letters’ contains, for example, the coding for the external conversion of primary cells into the respective required protein-forming muscle cells, skin cells, liver cells, nerve cells, brain cells or vitreous cells for the eyes in a mammal. And the ‘blueprint’ also contained in the overall code ensures that, during the development driven by continuous cell division from the first fertilised egg cell to the finished animal with trillions of cells, the respective protein building blocks are formed in the right place. The cells at the site of the future eyes read the code for the vitreous humour material according to the instructions in the overall plan and transform themselves externally into this material, so that the eyes can finally form in the foetus.
It is now easy to imagine that such a genome – even though the stored information is based on the same four ‘letters’ – must be a truly incomprehensibly complex structure of intertwined codes. And with a little mathematics, this becomes even more impressive. Namely, when the number of possible combinations within the ‘letter series’ is determined. The larger this number is, the more codes it can contain and the higher the potential complexity of the stored information.
The formula used to calculate the so-called ‘variation with repetition’ is suitable for mathematically determining the potential complexities within genomes. Written out in full, it simply reads: (n^k). The number of types of nucleotide bases available, i.e. A, T, G and C, becomes ‘n’ (n=4) and the placeholder for the length of the sequence is ‘k’. This makes it quite easy to see how the result changes in relation to the possible number of combinations when the length of the genome strand, i.e. k, is gradually increased.
Here are two examples of results:
n = 4
k = 10
(4^10) = 1,048,576
n = 4
k = 200
(4^200)=
2,582,250,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,00000.000.000.000.000.000,000,000,000,000,000,000,000.
The result for k=10, with just over a million and thus seven digits, is not particularly spectacular. But it is clear that increasing the series length k does not produce a linear result, but rather one that grows exponentially. Even increasing it 20-fold to k=200 suddenly produces an inconceivably gigantic number with 121 digits. In exponential notation, this may seem rather unspectacular again at 2.58 x 10^120. There are even names for such large numbers; in this case, it is called 2.58 vigintillion.
The estimated maximum number of all atoms in the universe pales in comparison to the number of possible combinations of even the smallest genomes.
However, what this really means can be guessed by looking at what astrophysicists estimate to be the upper limit in another context: namely, the maximum possible number of all atoms in the universe. This actually refers to the totality of all atomic particles that make up the entire universe with all its galaxies and celestial bodies. Even the number of atoms in a drop of water is beyond our imagination. The estimates for the entire universe range between 10^84 and 10^89 [3]. Even the highest estimate, i.e. 10^89, would fit around 10 quintillion times (factor 10^31) into the calculated number of 2.58 vigintillion possible variations at k=200.
But now something even more spectacular comes into play: there is no genetic material in living nature that is even remotely as ‘tiny’ as ‘only’ 200 base pairs. The smallest strands of genetic material are found in viruses, but their length is at least in the four-digit range. If we were to calculate the formula with k=1,000, the result would be so large that the estimated total number of atoms in the universe would be practically negligible in comparison. And in the case of metabolising organisms, such as bacteria or even plants and animals, the calculation becomes even more meaningless. The smallest bacterial genome found to date was detected in the leafhopper endosymbiont Carsonella ruddii, with almost 160,000 sequences of A, T, G and C. The result could not even be written out on this website.
Incidentally, it would be practically irrelevant if only a small proportion of the possible combinations of a genome were actually used for coding. So if only one thousandth of the potential is used, the absurdly long number is reduced by four digits.
It is this potential complexity of every genome, which extends almost to infinity, that makes its selective control from outside impossible – at least in the sense of a sustainable process. It should be noted that the many environmental influences affecting the life form are, in their entirety, even more complex than the genome itself.
Only if a life form aligns itself from generation to generation with its own interests, automatically taking into account all the countless environmental influences – or rather, is automatically aligned by them – can it remain stable in the long term. No matter how an external manipulator might try to permanently undermine this automatism in its favour, it could never succeed.
Assumed breeding conditions that resemble artificial breeding in nature are always based on distortions or errors – this also applies to obligatory mutualisms
All of the above also applies to the emergence of so-called ‘obligatory symbioses’. Such a symbiosis exists when different species have adapted to each other to such an extent that they cannot survive independently without the other side(s). Well-known examples are lichens, which are such a strongly intertwined obligatory symbiosis between algae and bacteria that, when viewed from the outside, they appear to be a single organism.
Many of the bacteria living in our human digestive tract are also obligatory symbiotic partners of our body. We need them, for example, to break down nutrients, regulate acids and defend against harmful microbes. However, these symbiotic partners never do any of this because our body has ‘bred’ them to do so. Instead, over millions of years of evolutionary selection, they have automatically adapted to serve their own primary interests. Because our body is their habitat, their ‘home’ so to speak, and – in the evolutionary sense of sustainability – is also supposed to be the home of their offspring, the development of characteristics that benefit us is something that primarily serves the interests of the bacteria. From the evolutionary perspective of the microorganism, our benefit is secondary. Those siblings among the bacteria that provided the greatest possible benefit to their habitat therefore always had a selective advantage and reproduced more frequently than those that were less successful or even harmed the host (i.e. their own habitat). As a result, the symbiosis grew to the mutual benefit of both parties.
Sometimes, when viewed superficially, obligatory symbioses appear as if there is such a thing as a ‘breeder’ and a bred ‘useful organism’ – in other words, a schematic similarity to our agricultural methods. However, these are always deceptions. This is particularly common in literature on leafcutter ants and certain species of the fungus Armillaria mellea. Over the course of probably around 70 million years of evolution, these two life forms have adapted so strongly to each other that neither the ants nor the fungus could exist independently. And because the symbiosis works in such a way that the fungus, which has always lived underground, is supplied with nutrients by the ants and in return produces small nodules that are ideal food for the ants, this is misinterpreted to mean that the ants have deliberately cultivated the fungus, just as ‘civilised humans’ have done with numerous grains, fruits and vegetables.
The obligatory mutual symbiosis between leafcutter ants and the fungus Armillaria mellea is one of the relatively well-researched ecological relationships. There are thousands of studies and many scientists have invested a large part of their work in this area. However, not a single characteristic of the fungus or the ant has ever been proven to have been developed for the exclusive benefit of the other party and through manipulation of the same. The fungus was not ‘forced’ by the ants to form nodules through breeding activities, but rather automatically ‘realised’ through natural selection that this effort ultimately benefits it because it allows it to attract and bind the ants to itself.
Conversely, the ants were not selectively forced by the fungus to align themselves in such a way that they would supply it in the soil. Instead, each step of their own adaptations was always taken primarily for their own benefit from the evolutionary ‘perspective’ of the symbiotic partners. The development of true obligatory symbioses with more pronounced physical characteristics is therefore a very long process, usually taking several or even many millions of years. And when the microorganisms involved are excluded, it is always only two or at least a few specific species that adapt to each other.
Not a single cultivated ‘useful organism’ of humans is a mutual symbiotic partner
In order to recognise that obligatory symbiosis in nature can at most have superficial similarities with human breeding practices involving ‘livestock’ and ‘crops’, three clear differences can be cited (in each case involving plants and animals, excluding the microbes involved):
1. In true obligatory mutualisms, only a few specific species are very specifically aligned with each other. Usually, there are two or at most three species.
2. The physical alignment of the characteristics of the partners relevant to obligatory mutualisms took place over periods of usually several million years.
3. In true obligatory mutualism, no characteristics can be found on either side that have successfully been brought about by the other side through targeted manipulation of the generational sequences.
None of these points apply to any of the relationships with our agricultural ‘beneficial organisms’. We have not spent millions of years adapting to a few specific partner species without deliberately manipulating them for our own benefit. Instead, within a few millennia, which is negligible in evolutionary terms, we have manipulated virtually every tangible life form for our own benefit without restraint.
Thus, in no single case are the relationships between humans and the numerous cultivated ‘farm animals’ and ‘crops’ genuine symbiosis. One could try to classify them in the category of parasitic effects. However, this is also problematic because, as explained above, no parasitic life forms or viruses have ever been detected in the ecosystem that intervene in the evolution of their hosts in this way. And the reason, which has also already been discussed, is that this must always end in an evolutionary dead end due to the uncontrollable complexities involved.
Through selection for our benefit in terms of their own sustainable survival, ‘farm animals’ and ‘crops’ have not gained any primary, let alone sustainable, benefit or advantage. Instead, they have all become weaker in the face of countless and extremely complex environmental influences. Particularly in the final phase of intensifying this selection process for the purpose of creating more benefits for humans, the weaknesses have increased accordingly.
It is sometimes argued that ‘farm animals’ and ‘farm crops’ have gained a great advantage by being reproduced by humans and their populations being greatly expanded geographically. However, when we consider the extreme degeneration of their genotype and phenotype, which has occurred in a tiny amount of time by evolutionary standards, as well as the actual inability of individuals to survive, this argument becomes illogical and absurd.
Contemporary intensive agriculture marks the end of the evolutionary dead end
What we can now observe in the fields of monocultures or in the halls of the animal husbandry industry are organisms that are so weak in the face of the many components of environmental pressure that they have to be supported at great expense and become even weaker with each generation – a process that is further accelerated by increasing levels of manipulation. This is why they require increasing amounts of water, fertiliser, insecticides, herbicides, fungicides, antibiotics, antivirals and many other aids.
The phase of intensification since the middle of the last century has led to a short-term sharp increase in the amount of food produced and, as a result, to an explosive increase in the human population from around 2.5 billion in 1950 to over eight billion in 2024. In the coming years of this dead-end situation, many different escalations will accelerate – if not slowed down – due to the inevitable further weakening of ‘beneficial organisms’ and further consequential damage. Among other things, these will put increasing pressure on the ecosystem. It is already foreseeable that this unnatural and therefore unstable structure of civilised agriculture will inevitably collapse in the not too distant future.
The fact that the natural law of free evolution, despite its extremely central importance and its factual confirmation by Charles Darwin himself, for example, is practically ignored in today’s natural sciences can be attributed to the same cause that largely obscures the connections and regularities discussed in the next section of the journal under the term ‘freedom’. These can also be explained in completely concrete and mechanical terms, even if the term might suggest something more philosophical. Furthermore, it will become apparent that the natural law of free evolution discussed here forms a solid foundation for the regular natural state of freedom. Because there is no sustainable possibility of interbreeding between different species, every living being of every species in the ecosystem is, in the true sense of the word, ‘born free’. A truly lasting relationship of subjugation between different species is therefore impossible in nature.
Conclusion
The ‘natural law of free evolution’ has always determined life on Earth and is based on the high complexity of all genomes, which cannot be controlled from outside. It was the basis for the more than 500 million years of history of higher life on the planet and for its enormous diversity and complexity. Only in free evolution can such a system arise and remain stable. Moreover, this law of nature is the very foundation of the central regularity of freedom, because it excludes the mutual subjugation of different species. The very broad orientation of humans against these central laws and regularities of nature since the ‘Neolithic Revolution’ has led the system of civilisation into an evolutionary dead end. Numerous parallel escalations in the present suggest that its end is either imminent or has already been reached.
[1] Charles Darwin, On the Origin of Species, 1859 Page 200 / 201. Source: http://darwin-online.org.uk/Variorum/1859/1859-200-dns.html
[2] Charles Darwin, On the Origin of Species, 1859 Page 29 / 30. Source: http://darwin-online.org.uk/Variorum/1859/1859-29-dns.html
[3] SWR Wissen: „Wieviele Atome gibt es im Universum“
https://www.swr.de/wissen/1000-antworten/wie-viele-atome-gibt-es-im-universum-100.html
[4] Written answer to Steffen Pichler on 05.08.2013 from the parasitologist Professor Dr. Richard Lucius, who has decades of research experience in various areas of his field and has also published specialised and non-fiction books providing a general overview of the range of parasitic strategies described. The question posed was whether he was aware of any parasitic strategies in which the parasite deliberately causes changes in the characteristics of the host’s subsequent generations for its own benefit. Professor Lucius’s answer:
‘That’s an interesting question, one that I’ve also asked myself. This could work, for example, through epigenetic changes induced by the parasite in the host’s germ line. However, only the manipulation of the current host using a wide variety of mechanisms is described, not that of its offspring.’